View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13206_high_24 (Length: 245)
Name: NF13206_high_24
Description: NF13206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13206_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 20 - 230
Target Start/End: Original strand, 52718162 - 52718364
Alignment:
| Q |
20 |
gtaaggttcttgaccggtccagctgtgattgcggcaacctcaatagcaattggtatccgtggagttctgttacatgttgcaattgttcaggtatgtgaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52718162 |
gtaaggttcttgaccggtccagctgtgattgcggcaacctcaatagcaattggtatccgtggagttctgttacatgttgcaattgttcaggtatgtgaaa |
52718261 |
T |
|
| Q |
120 |
ttaaattcagtttatcaattaatcaaaatgcttaataaattcagtttgttaccataattatgtttgattttaatttgcaggctgcacttccccaaggtat |
219 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52718262 |
ttaaattcagttt--------atcaaaatgcttaatatattcagtttgttaccataattttgtttgattttaatttgcaggctgcacttccccaaggtat |
52718353 |
T |
|
| Q |
220 |
tgttccctttg |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
52718354 |
tgttccctttg |
52718364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 52712508 - 52712599
Alignment:
| Q |
20 |
gtaaggttcttgaccggtccagctgtgattgcggcaacctcaatagcaattggtatccgtggagttctgttacatgttgcaattgttcaggt |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||| ||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52712508 |
gtaaggttcttggtcggtccagctgtgattgcggcaacctcgttagcagttggtctccgtggagttctcttacatgttgcaattgttcaggt |
52712599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University