View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13206_high_5 (Length: 477)
Name: NF13206_high_5
Description: NF13206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13206_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 206 - 473
Target Start/End: Complemental strand, 7679112 - 7678855
Alignment:
| Q |
206 |
gtggataacatagttgcttaaatagcttctagattactaaattaatgcatgcgctgattgcttgttagacaagttttttactctttagacatgattttgt |
305 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
7679112 |
gtggataacatagttgcttaaatagcctctagatcactaaattaatgcatgcgctgattgcttgttagacaaattttttactctttagacatggttttgt |
7679013 |
T |
|
| Q |
306 |
acgatttgaatacaaactaattattattattattagatgaaaaaattagcccacatcatcagctatgtgtgagacagacaatacaagaagggagattatt |
405 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
7679012 |
acgatttaaatacaaactaattatt------attagatgaaaaaattagcccgcatcatcagctatgtgtg----agacaatacaagaagggagattaat |
7678923 |
T |
|
| Q |
406 |
attactgtaacaatgacaaacaatgcttccccagtatgagggaaaatgttcttgactagtttcatttc |
473 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
7678922 |
attactgtaacaatgaccaacaatgcttccccagtatgagggacaatgttcttgactagtttcgtttc |
7678855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 104 - 133
Target Start/End: Complemental strand, 7679220 - 7679191
Alignment:
| Q |
104 |
tttgagatattataatgtgtttttgttgct |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7679220 |
tttgagatattataatgtgtttttgttgct |
7679191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University