View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13206_low_20 (Length: 298)
Name: NF13206_low_20
Description: NF13206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13206_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 6 - 295
Target Start/End: Complemental strand, 3625853 - 3625574
Alignment:
| Q |
6 |
atgctatggtctgtgacat-gaggagagtatgaatgaatcatggagtgattggagtggagccacatgttttacttccttcattttcctttttgaaaacaa |
104 |
Q |
| |
|
||||||| ||||||||||| |||||||||| ||||||||||||||| ||| ||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
3625853 |
atgctattgtctgtgacattgaggagagtaagaatgaatcatggag-----------gagtcacatgttttacttctttcattttcctttttggaaacaa |
3625765 |
T |
 |
| Q |
105 |
gcattttggactaaaaattacttcatccatccttaatcatagaccccttttttcttgttttaattaaggtgacaactacatcccatcaacaaagggtgaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3625764 |
gcattttggactaaaaattacttcatacatccttaatcatagacccgttttttcttgttttaattaaggtgacaactacatcccatcaacaaatggtgag |
3625665 |
T |
 |
| Q |
205 |
taaagttaccgataaaaaatgaattttagtattcacttgcacaatgataagtatcgtgccggactgccggtttatcaaagaattgtatcga |
295 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3625664 |
tagagttaccgataaaaaatgaattttagtattcacttgcacaatgataagtatcgtgccggactgccggtttatcaaagaattgtatcga |
3625574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University