View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13206_low_22 (Length: 267)
Name: NF13206_low_22
Description: NF13206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13206_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 5 - 254
Target Start/End: Complemental strand, 29653102 - 29652859
Alignment:
| Q |
5 |
tgttgaaaaaatgaagtaaatattcggcagcatcctaacattaaattgcaatcaagcgattagagaatagcgaagaaaagatgcctccaagtataacaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
29653102 |
tgttgaaaaaatgaagtaaatattcggcagcatcctaacattaaattgcaatcaagcggttagagaatagtgaagaaaagatgcctctaagtataacaat |
29653003 |
T |
 |
| Q |
105 |
gtaaatacctgttgtcaaaattgcaaccaagcaggtactagtaactacacagcttatcaaaaaccaaaagcaagtattgtacgacaaaatatctgttgtc |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
29653002 |
gtaaataccggttgtcaaaattgcaaccaagtaggt-------actacacagcttatcaaaaaccaaaagcaagtattatacggcaaaatatctgttgtc |
29652910 |
T |
 |
| Q |
205 |
gcgtag-tgaaaactctgaatggccgtctgcaactacagccttgaacatct |
254 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29652909 |
gcgtagatgaaaactctgaatggccgtctgcaactacagccttgaacatct |
29652859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University