View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13206_low_29 (Length: 239)
Name: NF13206_low_29
Description: NF13206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13206_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 39488513 - 39488286
Alignment:
| Q |
1 |
ttattcattcatcattttcattcacctaaaatatatacattaaagacatcaatgatatccaagtgaaatctcatatcagatgtggatgaaacattttctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39488513 |
ttattcattcatcattttcattcacctaaaatatatacattaaagacatcaatgacatccaagtgaaatctcatatgagatgtggatgaaacattttctt |
39488414 |
T |
|
| Q |
101 |
acttaaaattataaggattcaacgttcaaaagttcaaactgacagtctgattaggatcacctatattttgaacagttttcttgcatgcatgcaggtcaga |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39488413 |
acttaaaatta---ggattcaacgttcaaaagttcaaacagacagtctgattaggatcacctatattttgaacagttttcttgcatgcatgcaggtcaga |
39488317 |
T |
|
| Q |
201 |
gacactaagaggaatgttgactgatgatgtc |
231 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
39488316 |
gacactaagaggaatgttgacttatgatgtc |
39488286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University