View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13208_high_29 (Length: 238)
Name: NF13208_high_29
Description: NF13208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13208_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39869082 - 39869312
Alignment:
| Q |
1 |
taattaatttgttgattttgcaaacaaacaaacaaaatgcatatatgctgtccataaccaaattcatcgaattaaattctccctcaaagctgggtatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39869082 |
taattaatttgttgattttgcaaa----caaacaaaatgcatatatgctgtccataaccaaattcatcgaattaaattctccctcaaagctggttatgat |
39869177 |
T |
 |
| Q |
101 |
cgcaatggtggcaaagttctccataacgtgtatatttctgcctaagatggtttctacaatttttcgatacacaccagtgggg-------------atagt |
187 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
39869178 |
cgcaatggtggcaaagttatccataacgtgtatatttctgcctaagatggtttgtacaatttttcgatacacaccagtggggcagtggcggagccatagt |
39869277 |
T |
 |
| Q |
188 |
ggaggcccatagaggcaatagtcccccttaaaatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39869278 |
ggaggcccatagaggcaatagtcccccttaaaatt |
39869312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University