View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13208_low_11 (Length: 508)
Name: NF13208_low_11
Description: NF13208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13208_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 271 - 490
Target Start/End: Complemental strand, 35902245 - 35902026
Alignment:
| Q |
271 |
taggtttacgtggtaattgatctcgatcgttgatctgagatcgaacaatctggattacactatcaatttcaagcaccatttcttccattaacttgaatta |
370 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
35902245 |
taggattacgtggtaattgatctcgatcgttgatctgagatcgaacaatctggattacactatcaatttcaagcaccgtctcttccattaacttgaatta |
35902146 |
T |
|
| Q |
371 |
tattttgaattgattgatttactcatagaggatgtctaaaatgtcaggaagcttttgctataggagcgagggagagggctcatttgttagagccagatac |
470 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35902145 |
tattttgaattgattgatttactcatagaggatgtcttaaatgtcaggaagcttttgctataggagcgagggagagggctcatttgttagagccagatac |
35902046 |
T |
|
| Q |
471 |
aaatgcctggaagaaacttt |
490 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35902045 |
aaatgcctggaagaaacttt |
35902026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 8 - 220
Target Start/End: Complemental strand, 35902449 - 35902241
Alignment:
| Q |
8 |
agataatactggaattgagatgtttaaatatggagatcatattatgggaatccaaggtcatccagagtactctaaagatattcttttgtttcttatcgat |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35902449 |
agataaaactggaattgagatgtttaaatatggagatcatattatgggaatccaaggtcatccagagtactctaaagatattcttttgtttcttatcgat |
35902350 |
T |
|
| Q |
108 |
cgtctcatccaacgtaatttcatcaaggtatgtccaatatatttctagttttatttagagaatttcaattttctattactttagagcacgtcgaccatca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35902349 |
cgtctcatccaacgtaatttcatcaaggtatgtcca----atttctagttttatttagagaatttcaattttctattactttagagcacgtcgaccatca |
35902254 |
T |
|
| Q |
208 |
taaagaactagga |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35902253 |
taaagaactagga |
35902241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 37024484 - 37024571
Alignment:
| Q |
8 |
agataatactggaattgagatgtttaaatatggagatcatattatgggaatccaaggtcatccagagtactctaaagatattcttttg |
95 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||| |||||||||||||| || |||||| |
|
|
| T |
37024484 |
agataagactggaattgagatgtttagatatggagatcacattatgggaattcaaggtcatcctgagtactctaaagacatccttttg |
37024571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University