View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13208_low_31 (Length: 236)
Name: NF13208_low_31
Description: NF13208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13208_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 40255905 - 40256113
Alignment:
| Q |
12 |
aagcaaaggcgaaccatgaacataactgcgataagatagtaattttttagaacaaacaatcaaaatttatctgtacgtttctgtgtgtagctgtacttta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40255905 |
aagcaaaggcgaaccatgaacataactgcgataagatagtaattttttagaacaaacaatcaaaatttatttgtacgtttctgtgtgtagctgtacttta |
40256004 |
T |
 |
| Q |
112 |
atatttctcactagggctcaccagtacaatgtgctgtaagtacatagcctccttttcttattataaataaaactaagatgtatagtgctaatcattgaca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40256005 |
atatttctcactagggctcaccagtacaatgtgctgcaagtacatagcctccttttcttattataaataaaactaagatgtatagtgctaatcattgaca |
40256104 |
T |
 |
| Q |
212 |
tatacatag |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
40256105 |
tatacatag |
40256113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University