View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13209_low_25 (Length: 308)
Name: NF13209_low_25
Description: NF13209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13209_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 113 - 246
Target Start/End: Complemental strand, 27790656 - 27790523
Alignment:
| Q |
113 |
ctttttatattagatttcaagtattgctgggaaaaatgggaaagtgattacctaactaaacaaaacgctgatcctctaatacaaaaggaataacattcaa |
212 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27790656 |
ctttttatatgagatttcaagtactgctgggaaaaatgggaaagtgattacctaactaaacaaaacgctgatcctctaatacaaaaagaataacattcaa |
27790557 |
T |
|
| Q |
213 |
tctaactcagctatgaagaatggtgcacaaatac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27790556 |
tctaactcagctatgaagaatggtgcacaaatac |
27790523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 27790796 - 27790690
Alignment:
| Q |
1 |
gatattgtttttagattttaacacctgaaaattgtggtgaatgattttcaaatttgtagttaaggaaattatgctaatagctagtagaaagtgattacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27790796 |
gatattgtttttagattttaacacctgaaaattgtggtgaatgattttcaaatttgtagttaaggaaattatgctaatagctagtagaaagtgattacct |
27790697 |
T |
|
| Q |
101 |
aattttg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
27790696 |
aattttg |
27790690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 291
Target Start/End: Complemental strand, 27790230 - 27790196
Alignment:
| Q |
257 |
tcatccgcgcccccatcctcaacatccatttcatc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27790230 |
tcatccgcgcccccatcctcaacatccatttcatc |
27790196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University