View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13209_low_33 (Length: 238)
Name: NF13209_low_33
Description: NF13209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13209_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 10202377 - 10202597
Alignment:
| Q |
1 |
ccaacttgtatcttgtcacatggtggagaaaacacttgtaagcttcgtcgtttcgatcctgaacggggtctgctaagtctttcccgtgaaacgcgaaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
10202377 |
ccaacttgtatcttgtcacatggtggagaaaacacttgtaagcttcgtcgtttcgatcctgaaccgggtctgctaagtctttcccgtgaaacgcgaaaca |
10202476 |
T |
|
| Q |
101 |
tccagggatgttaagcggttcagggatatccctaaactcaccctgaactctttggtcgagttggggaaaataaaaggcaaaggacaagttattggcattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10202477 |
tccagggatgttaagcggttcagggatatccctaaactcaccctgaactctttgggcgagttggggaaaataaaaggcaaaggacaagttattggcattt |
10202576 |
T |
|
| Q |
201 |
gtagggaagtagagatatgaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10202577 |
gtagggaagtagagatatgaa |
10202597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 10209450 - 10209666
Alignment:
| Q |
1 |
ccaacttgtatcttgtcacatggtggagaaaacacttgtaagcttcgtcgtttcgatcctgaacggggtctgctaagtctttcccgtgaaacgcgaaaca |
100 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||||||| |||||||| |||||||||||||| ||||||| ||||||||||||||||| ||| ||||| |
|
|
| T |
10209450 |
ccaacctgtgtcttgtcatttggtggagaaaacacttgtaggcttcgtcctttcgatcctgaaccgggtctggtaagtctttcccgtgaaccgcaaaaca |
10209549 |
T |
|
| Q |
101 |
tccagggatgttaagcggttcagggatatccctaaactcaccctgaactctttggtcgagttggggaaaataaaaggcaaaggacaagttattggcattt |
200 |
Q |
| |
|
||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
10209550 |
tcctgggatgttaagcggttcaaggatatccctaaactcaccctgaactttttggtcgagttggggaaaataaaaggcaaaggacaacatattggcagtg |
10209649 |
T |
|
| Q |
201 |
gtagggaagtagagata |
217 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
10209650 |
gaagggaagtagagata |
10209666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University