View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13209_low_35 (Length: 230)

Name: NF13209_low_35
Description: NF13209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13209_low_35
NF13209_low_35
[»] chr4 (1 HSPs)
chr4 (35-214)||(52369465-52369646)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 35 - 214
Target Start/End: Complemental strand, 52369646 - 52369465
Alignment:
35 actaaatacataactaactagttt--caaagttaattgagtacacttattggaggctaactatgaaactttactatacgatgatgacagatatcataatt 132  Q
    ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52369646 actaaatacataactaactagtttttcaaagttaattgagtacacttattggaggctaactatgaaactttactatacgatgatgacagatatcataatt 52369547  T
133 tgttgaacaaatgaatgcaattatttggttttgaccaatataataaatattcaactactatatggcatggctgctaatttat 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52369546 tgttgaacaaatgaatgcaattatttggttttgaccaatataataaatattcaactactatatggcatggctgctaatttat 52369465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University