View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13209_low_37 (Length: 223)
Name: NF13209_low_37
Description: NF13209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13209_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 26 - 208
Target Start/End: Complemental strand, 31155980 - 31155798
Alignment:
| Q |
26 |
aactaaaagaggttctaaaaactgcagaacaaaagttgtttcggttcaaggaaaaactgaaacaagttccaagcataaaagaattaacaagaacaaaacc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31155980 |
aactaaaagaggttctaaaaactgcagaccaaaaattgtttgggttcaaggcaaaaccgaaacaagttccaagcataaaagaattaacaagaacaaaacc |
31155881 |
T |
 |
| Q |
126 |
atcctattatgaagcacatacacagatatggacatgagacacgccactgagtttgaagaggaatcttagcagtggatggttgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31155880 |
atcctattatgaagcacatacacagatatggacatgagacacgacactgagtttgaagaggaatcttagcagtggatggttgt |
31155798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University