View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320A-Insertion-10 (Length: 341)
Name: NF1320A-Insertion-10
Description: NF1320A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320A-Insertion-10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 8 - 337
Target Start/End: Original strand, 2364808 - 2365134
Alignment:
| Q |
8 |
ctatccaccacaatctgcatatccacctcaaggaggttattatccacaacaatatccaccaaatgcaggaggagggtatccaccttctggttatcctcat |
107 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2364808 |
ctatcccccacaatctacatatccacctcaaggaggttattatccacaacaatatccaccaaatgcaggaggagggtatccaccttctggttatcctcat |
2364907 |
T |
|
| Q |
108 |
catcaaccatcttatcatgcaccacatggttatccttcaggtacacttgatcatcctaatttgttatcagtaataaacatatcagcgattcaagtactcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
2364908 |
catcaaccatcttatcatgcaccacatggttatccttcaggtacacttgatcatcctaatttgttatcagtaataaacat---agcgattcgagtactcc |
2365004 |
T |
|
| Q |
208 |
ttgtacttgcttcggcttcttcctttatttatatattcgatttccatttttnnnnnnngtaataaatatattagcatgcatataaacaatcttttatgat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2365005 |
ttgtacttgcttcggcttcttcctttatttatatattcgatttccatttttaaaaaaagtaataaatatattagcatgcatataaacaatcttttatgat |
2365104 |
T |
|
| Q |
308 |
ctacctgatgttggtttatatttttcacaa |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2365105 |
ctacctgatgttggtttatatttttcacaa |
2365134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 12 - 107
Target Start/End: Original strand, 2368580 - 2368678
Alignment:
| Q |
12 |
ccaccacaatctgcatatccacctcaaggaggttattatccacaacaatatccaccaaatgca---ggaggagggtatccaccttctggttatcctcat |
107 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||| ||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
2368580 |
ccaccacaaactgcatatccacctcaaggaggttattatccttcacagtatccaccacatgcagccggaggagggtatccaccttccggttatcctcat |
2368678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University