View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320A-Insertion-25 (Length: 322)
Name: NF1320A-Insertion-25
Description: NF1320A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320A-Insertion-25 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 322
Target Start/End: Original strand, 39378127 - 39378441
Alignment:
| Q |
8 |
gaacccgtaccagctttattctcaccttgcttttgattctcaacatcaacannnnnnngtgatatttccacgtcactatctgaagaactttgtgtctctg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39378127 |
gaacccgtaccagctttattctcaccttgcttttgattctcagcatcaacatttttttgtgatatttccacgtcactatctgaagaactttgtgtctccg |
39378226 |
T |
|
| Q |
108 |
aggattcttcatcttctgttctttttcttaaacaagaccaccttgtaaacccttttgtctctaaggttgaagaagaattctcacttcttgtagtagcagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| | |
|
|
| T |
39378227 |
aggattcttcatcttctgttctttttcttaaacaagaccaccttgtaaacccttttgtctctaaggttgatgaagaattctcacttcttgcagtagcaac |
39378326 |
T |
|
| Q |
208 |
ttcattttttattgcattttccgcatcnnnnnnnctctttagcttataaacataaacaaaaaccatagctaagattccaattccaacgaaatcaccaata |
307 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39378327 |
ttcattttttattgcattttccgcatctttttttctctttagcttataaacataaacaaaaaccatagctaagattccaattccaacgaaatcaccaata |
39378426 |
T |
|
| Q |
308 |
acaattcctataata |
322 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39378427 |
acaattcctataata |
39378441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University