View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1320A-Insertion-26 (Length: 151)

Name: NF1320A-Insertion-26
Description: NF1320A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1320A-Insertion-26
NF1320A-Insertion-26
[»] chr1 (1 HSPs)
chr1 (7-151)||(6820711-6820855)
[»] chr8 (1 HSPs)
chr8 (15-82)||(7333092-7333159)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 7 - 151
Target Start/End: Complemental strand, 6820855 - 6820711
Alignment:
7 acaatgacctttagttgctttacacaagcctttatcccttctgtttcttctgctttccgaagctggttatgcatttgatccaatgtaacacacattgagt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||    
6820855 acaatgacctttagttgctttacacaagcctttatcccttctgtttcttcagctttccgaagctggttatgcatttgatccaatgtaacacatattgagt 6820756  T
107 tcataaccgttcgtacttgctttgagcttgattccagatttttca 151  Q
    |||||||||||  ||||||||||||||||||||||||||||||||    
6820755 tcataaccgttactacttgctttgagcttgattccagatttttca 6820711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 82
Target Start/End: Complemental strand, 7333159 - 7333092
Alignment:
15 ctttagttgctttacacaagcctttatcccttctgtttcttctgctttccgaagctggttatgcattt 82  Q
    |||||||| |||||||||||| |||  ||||||||||| |||||||| |  |||||| ||||||||||    
7333159 ctttagttcctttacacaagcatttcgcccttctgttttttctgcttccttaagctgcttatgcattt 7333092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University