View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320A-Insertion-26 (Length: 151)
Name: NF1320A-Insertion-26
Description: NF1320A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320A-Insertion-26 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 7 - 151
Target Start/End: Complemental strand, 6820855 - 6820711
Alignment:
| Q |
7 |
acaatgacctttagttgctttacacaagcctttatcccttctgtttcttctgctttccgaagctggttatgcatttgatccaatgtaacacacattgagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6820855 |
acaatgacctttagttgctttacacaagcctttatcccttctgtttcttcagctttccgaagctggttatgcatttgatccaatgtaacacatattgagt |
6820756 |
T |
|
| Q |
107 |
tcataaccgttcgtacttgctttgagcttgattccagatttttca |
151 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6820755 |
tcataaccgttactacttgctttgagcttgattccagatttttca |
6820711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 15 - 82
Target Start/End: Complemental strand, 7333159 - 7333092
Alignment:
| Q |
15 |
ctttagttgctttacacaagcctttatcccttctgtttcttctgctttccgaagctggttatgcattt |
82 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||| |||||||| | |||||| |||||||||| |
|
|
| T |
7333159 |
ctttagttcctttacacaagcatttcgcccttctgttttttctgcttccttaagctgcttatgcattt |
7333092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University