View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320F-Insertion-3 (Length: 298)
Name: NF1320F-Insertion-3
Description: NF1320F
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320F-Insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 19456972 - 19457100
Alignment:
| Q |
9 |
atattttatcaggtgattaagcatatggcagatcttacatagctttgcaaatcatggatataactttccaacagagtcaagtattgtgatggatcatatg |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19456972 |
atattttatcagatgattaagcatatggaagatcttgcatagctttgcaaatcatggatataactttccgacagagtcaagtattgtgatggatcatatg |
19457071 |
T |
|
| Q |
109 |
tgaatgtttttgctgctgaattaaacttt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19457072 |
tgaatgtttttgctgctgaattaaacttt |
19457100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 235 - 298
Target Start/End: Original strand, 19457199 - 19457263
Alignment:
| Q |
235 |
agaataagagtttgtgtagaaacgttgcatccaattc-taagtcatgtgatggtgtcatattaga |
298 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| || ||||||||||||| |||||||||||| |
|
|
| T |
19457199 |
agaataagagtttctgtagaaatgttgcatccaactcttaagtcatgtgataatgtcatattaga |
19457263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 16679037 - 16679136
Alignment:
| Q |
8 |
catattttatcaggtgattaagcatatggcagatcttacatagctttgcaaatcatggatataacttt-ccaacag----agtcaagtattgtgatggat |
102 |
Q |
| |
|
|||||||| ||||||||||| |||| ||| ||||||| ||| | ||||||| |||| || |||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
16679037 |
catattttctcaggtgattatgcatgtggaagatcttgcattgttttgcaagtcatagacataactttcccaacagagccagtaaagtattgtgatggat |
16679136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University