View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320R-Insertion-26 (Length: 88)
Name: NF1320R-Insertion-26
Description: NF1320R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320R-Insertion-26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 22 - 88
Target Start/End: Complemental strand, 48374545 - 48374479
Alignment:
| Q |
22 |
acgagtaatgaacttttatatttcactataactttggtagacgtttaatcctttggataagctttta |
88 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48374545 |
acgagtaacgaacttttatatttcattataactttggtagacgtttaatcctttggataagctttta |
48374479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University