View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320_high_27 (Length: 421)
Name: NF1320_high_27
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 29 - 416
Target Start/End: Complemental strand, 37385811 - 37385421
Alignment:
| Q |
29 |
actcaagtcacattagagttagttactacacatgacaatgaaaggaggacagagaaagaaccttctatacacaaaca---ttctgtgcttccttttgctt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
37385811 |
actcaagtcacattagagttagttactacacatgacaatgaaaggaggacagagaaagaaccttctatacacaaacaatattctgtgcatccttttgctt |
37385712 |
T |
 |
| Q |
126 |
caatggcttgatctctccttagtaaagagtgctaaggttccggcgatcatagtgttcggcgactcatccgtggatgccgggaacaacaacttcatatcga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385711 |
caatggcttgatctctccttagtaaagagtgctaaggttccggcgatcatagtgttcggcgactcatccgtggatgccgggaacaacaacttcatatcga |
37385612 |
T |
 |
| Q |
226 |
cggttgctcggagcaatttccagccgtatggacgtgattttctgggtgggaagccaactgggagattcagcaatggtagaatagcgactgatttcatatc |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37385611 |
cggttgctcggagcaatttccagccgtatggacgtgattttctgggtgggaagccaactgggagattcagcaatggtagaatagcaactgatttcatatc |
37385512 |
T |
 |
| Q |
326 |
agaagcatttggtatcaaaccatacataccggcatacttggaccctagctttaacatctcacagtttgcaactggtgtctcctttgcttct |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37385511 |
agaagcatttggtatcaaaccatacataccagcatacttggaccctagctttaacatctcacagtttgcaactggtgtctcctttgcttct |
37385421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 153 - 267
Target Start/End: Original strand, 36599013 - 36599127
Alignment:
| Q |
153 |
agtgctaaggttccggcgatcatagtgttcggcgactcatccgtggatgccgggaacaacaacttcatatcgacggttgctcggagcaatttccagccgt |
252 |
Q |
| |
|
||||| ||||||||||| || || |||||||| ||||| ||||| ||||||||||| ||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
36599013 |
agtgcaaaggttccggcaataatcgtgttcggagactcttccgttgatgccgggaataacaacttcattccgacggttgcacggagcaattttcagccgt |
36599112 |
T |
 |
| Q |
253 |
atggacgtgattttc |
267 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
36599113 |
atggacgtgactttc |
36599127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University