View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320_high_61 (Length: 260)
Name: NF1320_high_61
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320_high_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 28 - 245
Target Start/End: Complemental strand, 29110867 - 29110650
Alignment:
| Q |
28 |
ctacacacactatctaatttgaggagtatatatgaacatgaccatacatacatgtactattattaattcgataagattatagttatgaatttatgatggt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29110867 |
ctacacacactatctaatttgaggagtatatatggatatgaccatacatacatgtactattattaattcgataagattatagttatgaatttatgatggt |
29110768 |
T |
|
| Q |
128 |
tttggttggcgttgttaattatgcagccttgaagtatggtattttatggcattaatactatttgctggatatctggagaatgcagaagtttcagttgatg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29110767 |
tttggttggcgttgttaattatgcagccttgaagtatggtattttatggcattaatactatttgctggatatctggagaatgcagaagtttcagttgatg |
29110668 |
T |
|
| Q |
228 |
cattgtctatatggtgag |
245 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29110667 |
cattgtctatatggtgag |
29110650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 163 - 242
Target Start/End: Complemental strand, 14266694 - 14266615
Alignment:
| Q |
163 |
atggtattttatggcattaatactatttgctggatatctggagaatgcagaagtttcagttgatgcattgtctatatggt |
242 |
Q |
| |
|
|||||| ||||||||||| || || |||||||||||||| ||||||||||| | ||||| ||||| || ||||| |||| |
|
|
| T |
14266694 |
atggtactttatggcattgattctgtttgctggatatctcaagaatgcagaaatctcagtagatgccttctctatctggt |
14266615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University