View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320_low_49 (Length: 332)
Name: NF1320_low_49
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 257 - 320
Target Start/End: Complemental strand, 27929274 - 27929211
Alignment:
| Q |
257 |
ttgcaaaaagaaaacaattgagcaaaaataaatgtttaaagaaagaataattgtctctgatatt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27929274 |
ttgcaaaaagaaaacaattgagcaaaaataaatgtttaaagaaagaataattgtctctgatatt |
27929211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 257 - 320
Target Start/End: Original strand, 28082563 - 28082626
Alignment:
| Q |
257 |
ttgcaaaaagaaaacaattgagcaaaaataaatgtttaaagaaagaataattgtctctgatatt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28082563 |
ttgcaaaaagaaaacaattgagcaaaaagaaatgtttaaagaaagaataattgtctctgatatt |
28082626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University