View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320_low_55 (Length: 288)
Name: NF1320_low_55
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 122 - 218
Target Start/End: Original strand, 4402939 - 4403035
Alignment:
| Q |
122 |
tcatcagttattcatttctagaaatgttattttctatgagctgcattttccttttcataatttttcgtcatcttctacatcaagttcacctttacct |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
4402939 |
tcatcagttattcatttctagaaataatattttctatgagctgcattttccttttcatgtttcttcgtcatcttctacatcaagttcacctttacct |
4403035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 47 - 179
Target Start/End: Original strand, 6096459 - 6096591
Alignment:
| Q |
47 |
tcatagggctagaaaggctgtttttcttggttacaaagagggagtcaaaggatatattctctatgagttactttctcatcagttattcatttctagaaat |
146 |
Q |
| |
|
|||||| |||||||| | |||||||||||||| |||||||| || || || |||||| | ||||| || | ||||||||| | | |||||||| ||| |
|
|
| T |
6096459 |
tcatagagctagaaaaacagtttttcttggttataaagagggtgtaaagggctatattttgtatgatttgcattctcatcaaatgattatttctaggaat |
6096558 |
T |
 |
| Q |
147 |
gttattttctatgagctgcattttccttttcat |
179 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| |
|
|
| T |
6096559 |
gttattttctttgaggatcattttccttttcat |
6096591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University