View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320_low_73 (Length: 252)
Name: NF1320_low_73
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320_low_73 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 8577923 - 8578147
Alignment:
| Q |
1 |
tttgttaaaccatttgctcaaagttcctaaacgttataatctcttaaaacaatgattattactaaccaactctattaattatttaaattatctgttataa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8577923 |
tttgttaaaccatttgctcaaagttactaaacgttataatctcttaaaacaatgattattactaaccaactctattaattatttaaattatctgttataa |
8578022 |
T |
 |
| Q |
101 |
tgagaatcttttaacctgtcaaaaatatttttcccgatccagtatatttcttttggtggtgctctctacaatttttgctataagtttatccaactatatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8578023 |
tgagaatcttttaacctgtcaaaaatatttttcccgatccagtatatttcttttggtggtgttctctacaatttttgctataagtttatccaactatata |
8578122 |
T |
 |
| Q |
201 |
tttagtaaatttattgtcaatattg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8578123 |
tttagtaaatttattgtcaatattg |
8578147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University