View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1320_low_77 (Length: 242)

Name: NF1320_low_77
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1320_low_77
NF1320_low_77
[»] chr3 (1 HSPs)
chr3 (150-228)||(46267318-46267396)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 150 - 228
Target Start/End: Complemental strand, 46267396 - 46267318
Alignment:
150 aagaattagagtgaacaagagatcaaaggttgtaataagcaaagtaaacacttgttccatcttaagacatataatttag 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46267396 aagaattagagtgaacaagagatcaaaggttgtaataagcaaagtaaacacttgttccatcttaagacatataatttag 46267318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University