View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320_low_93 (Length: 202)
Name: NF1320_low_93
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320_low_93 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 3e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 35767868 - 35767805
Alignment:
| Q |
1 |
tgattttattattctcttttcctttggtttgattattcttcagttgttacattgcatggatcaa |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35767868 |
tgattttattattctcttttcctttggtttgattattcttcagttgttacattgcatggatcaa |
35767805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University