View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1320_low_95 (Length: 201)
Name: NF1320_low_95
Description: NF1320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1320_low_95 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 35767844 - 35767956
Alignment:
| Q |
1 |
aaaggaaaagagaataataaaatcaaaataaactaacccaatggtggttttccataggatgaggaggatctcctctgacccacttgatgatgattgctga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35767844 |
aaaggaaaagagaataataaaatcaaaataaactaacccaatggtggttttccataggatgaggaggatctcctctgacccacttgatgatgattgctga |
35767943 |
T |
|
| Q |
101 |
tccctttgctact |
113 |
Q |
| |
|
||| |||| |||| |
|
|
| T |
35767944 |
tccttttgttact |
35767956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 31 - 106
Target Start/End: Original strand, 35762587 - 35762665
Alignment:
| Q |
31 |
aactaacccaatggtggttttcc---ataggatgaggaggatctcctctgacccacttgatgatgattgctgatccctt |
106 |
Q |
| |
|
||||||||||| ||||| ||||| |||||| ||||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
35762587 |
aactaacccaaaggtggctttcctttataggacgaggaggatttccagtgacccacttgatgatgattactgatccctt |
35762665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University