View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13210_high_9 (Length: 334)

Name: NF13210_high_9
Description: NF13210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13210_high_9
NF13210_high_9
[»] chr7 (2 HSPs)
chr7 (19-207)||(46748686-46748874)
chr7 (295-326)||(46748579-46748610)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 46748874 - 46748686
Alignment:
19 ttgagaagggatgatgtaagcgtcaatggagacatcgggtttggagaagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacga 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
46748874 ttgagaagggatgatgtaagcgtcaatggagacatcgggtttggagaagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacgg 46748775  T
119 tttttacggagttgggaagatggtttcgctgagatggaattggaagtggtgcaattgcggatggagaagaaaggaggtttgttatgttt 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
46748774 tttttacggagttgggaagatggtttcgctgagatggaattggaagtggtgcaattgcggatggagaagaaagggggtttgttatgttt 46748686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 295 - 326
Target Start/End: Complemental strand, 46748610 - 46748579
Alignment:
295 tttcgttacagttgcaggtgatgatgatgatg 326  Q
    ||||||||||||||||||||||||||||||||    
46748610 tttcgttacagttgcaggtgatgatgatgatg 46748579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University