View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13210_low_10 (Length: 334)
Name: NF13210_low_10
Description: NF13210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13210_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 9e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 46748874 - 46748686
Alignment:
| Q |
19 |
ttgagaagggatgatgtaagcgtcaatggagacatcgggtttggagaagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748874 |
ttgagaagggatgatgtaagcgtcaatggagacatcgggtttggagaagagacggcggagggcggtgagtttggggtcggagtcggaatttgaggaacgg |
46748775 |
T |
 |
| Q |
119 |
tttttacggagttgggaagatggtttcgctgagatggaattggaagtggtgcaattgcggatggagaagaaaggaggtttgttatgttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46748774 |
tttttacggagttgggaagatggtttcgctgagatggaattggaagtggtgcaattgcggatggagaagaaagggggtttgttatgttt |
46748686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 295 - 326
Target Start/End: Complemental strand, 46748610 - 46748579
Alignment:
| Q |
295 |
tttcgttacagttgcaggtgatgatgatgatg |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46748610 |
tttcgttacagttgcaggtgatgatgatgatg |
46748579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University