View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_high_11 (Length: 382)
Name: NF13212_high_11
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 134 - 372
Target Start/End: Original strand, 27885069 - 27885307
Alignment:
| Q |
134 |
gtaggagagggtggtgataaaggggagagtgcagggagtatggtacagaaactggacagtggaaaatgcgagggaattggggctaaaaggatgggttcgg |
233 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
27885069 |
gtaggagagggtggtgataaaggggagggtgcaaggagtatggtatagaaactggacagtggaaaatgctagggaattagggctaaaaggatgggttcgg |
27885168 |
T |
|
| Q |
234 |
aaccggagggatggttctgtggaggctctgttctctggcaacgccgatgcggtgaaggaaatggagatcaggtgtcgccgtggtccacctgatgctgctg |
333 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| | || ||| || ||| ||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
27885169 |
aaccggagggatggggctgtggaggctctgttctctggtagcgtcgaagcagtgcaggaaatggagcggaggtgtcgtcgtggtccacctgatgctgctg |
27885268 |
T |
|
| Q |
334 |
ttactgggcttgaggtttttccatgcggtgatgatgatg |
372 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27885269 |
ttactgggcttgaggtttttccatgtggtgatgatgatg |
27885307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 251 - 330
Target Start/End: Original strand, 27886890 - 27886969
Alignment:
| Q |
251 |
tgtggaggctctgttctctggcaacgccgatgcggtgaaggaaatggagatcaggtgtcgccgtggtccacctgatgctg |
330 |
Q |
| |
|
|||| ||||||||||||| |||| | |||||||||| |||||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
27886890 |
tgtgaaggctctgttctccggcagtgtcgatgcggtgcaggaaacggagcagaggtgtcgtcgtggtccacctgatgctg |
27886969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University