View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_high_14 (Length: 337)
Name: NF13212_high_14
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 38677929 - 38677688
Alignment:
| Q |
18 |
catgtagcaacaatttcaaagtgagagcttcaagttaatacctttttctgtgtcatcttccttaataatatta------------ttattgctcttagat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38677929 |
catgtagcaacaatttcaaagtgagagcttcaagttaatacctttttctgtgtcatcttccttaataatattagcacagttaatattattgctcttagat |
38677830 |
T |
 |
| Q |
106 |
gcaccctcttcagcgaaatcttcaagtttaaacgtaggcttccaaacaccaacaactctattttcttccttaatattttcactcattttgttcttccaac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38677829 |
gcaccctcttcagcgaaatcttcaagtttaaacgtaggcttccaaacaccaacaactctattttcttccttaatattttcactcattttgttcctccaac |
38677730 |
T |
 |
| Q |
206 |
ggtcacgtgtctcacgcatgtttctcactagagcaaaaaacg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38677729 |
ggtcacgtgtctcacgcatgtttctcactagagcaaaaaacg |
38677688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University