View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_high_19 (Length: 319)
Name: NF13212_high_19
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 76 - 164
Target Start/End: Complemental strand, 15294414 - 15294328
Alignment:
| Q |
76 |
tttaccaaactcaactgtcttcactctcgatttgtttttctaccataatatatgttccccttcctctgttgagagttgccgatatacaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15294414 |
tttaccaaactcaactgtcttcactctcgatttgtttttctaccata--atatgttccccttcctctgttgagagttgccgatatacaa |
15294328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 15294254 - 15294321
Alignment:
| Q |
224 |
ctttagacttggagttcatttttagtgcatgtttggctatatggcgatgtatgttcggtactgtagtg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||| |
|
|
| T |
15294254 |
ctttagacttggagttcatttttagtgcatgtttggttatatggtgatgtatgttcggttctgtagtg |
15294321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University