View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_high_37 (Length: 239)
Name: NF13212_high_37
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1123045 - 1122826
Alignment:
| Q |
1 |
ataatattaaattgagtatattctagtaaaaaggtcatgtgacactttctttttctaatttgaagacacaatggcacaatgatgtctatgtaaagtaacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
1123045 |
ataatattaaattgagtatattctagtaaaaaggtcacgtgacactttctttttctgatttgaagacacaatgacacagtgatgtctcagtaaagtaacg |
1122946 |
T |
 |
| Q |
101 |
tgtatatccagacnnnnnnntactgtaagcatatgcgggcggctccgggtaccgatggattcagaaattaatccgcaccttcccgtttcaaaccgtgtta |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||| || |||||||| || |||| |
|
|
| T |
1122945 |
tgtatatccagac-aaaaaatactgtaagcatatgcgggcgggttccggtaccgatggattcagaaattaatccgcacctgcctgtttcaaatcgggtta |
1122847 |
T |
 |
| Q |
201 |
aaccgattctgacagtctgct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1122846 |
aaccgattctgacagtctgct |
1122826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 8174517 - 8174464
Alignment:
| Q |
164 |
gaaattaatccgcaccttcccgtttcaaaccgtgttaaaccgattctgacagtc |
217 |
Q |
| |
|
|||||||||| |||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8174517 |
gaaattaatctgcacctgcccgtttcaaaccatgttaaaccgattctgacagtc |
8174464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University