View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13212_high_38 (Length: 239)

Name: NF13212_high_38
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13212_high_38
NF13212_high_38
[»] chr4 (1 HSPs)
chr4 (2-239)||(29090200-29090431)


Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 2 - 239
Target Start/End: Original strand, 29090200 - 29090431
Alignment:
2 agaaagagaggaagtatacgaagatcaatgttaataggatactcattcataatcatatggttattgttgattgatttcataatgagcttgttgcattctt 101  Q
    |||||||||||||||||| ||||||||||| |||||||||||||||||||      ||||||||||||||| ||||||||||||||||||||||||||||    
29090200 agaaagagaggaagtatatgaagatcaatggtaataggatactcattcat------atggttattgttgatggatttcataatgagcttgttgcattctt 29090293  T
102 cctccatggacgctgacatagttcttgtcgatagattccacaacaagtttattgcactcttctccatggcacaattgacatccttggaggaagaaaacag 201  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29090294 cctccatggacgctgacatagttcttgtcgatagataccacaacaagtttattgcactcttctccatggcacaattgacatccttggaggaagaaaacag 29090393  T
202 ccatggaagatgagtgcaatatactcatcatggaatct 239  Q
    ||||||||||||||||||||||||||||||||||||||    
29090394 ccatggaagatgagtgcaatatactcatcatggaatct 29090431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University