View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13212_high_43 (Length: 202)

Name: NF13212_high_43
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13212_high_43
NF13212_high_43
[»] chr5 (1 HSPs)
chr5 (66-147)||(15293965-15294046)


Alignment Details
Target: chr5 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 66 - 147
Target Start/End: Original strand, 15293965 - 15294046
Alignment:
66 gaagtaacggattgacaccgtaactatatgaaaagaagtaactttactggagacggatcaaatatccaatttagcctaaatg 147  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
15293965 gaagtaacagattgacaccgtaactatatgaaaagaagtaactttactggagaccgatcaaatatccaatttagcctaaatg 15294046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University