View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_low_13 (Length: 358)
Name: NF13212_low_13
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 20 - 350
Target Start/End: Complemental strand, 35352813 - 35352482
Alignment:
| Q |
20 |
catcgaacttctactcaagtgatttcatctctccaaagagacgatgttggcatcaacaaccttgcatcctgggacatatgaactgcagcatcgtggaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35352813 |
catcgaacttctactcaagtgatttcatctctccaaagagacgatgttggcatcaacaaccttgcatcctgggacatatgaactgcagcatcgtggaact |
35352714 |
T |
 |
| Q |
120 |
ttagtatcacactctcaatgtcttcaacatcgattatgttaccatttcctaacttgaaatccccaaacacgccattagtctttaaggtgtcgaatatcct |
219 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35352713 |
ttagtatcacactctcaatgccttcaacatcgattatgttaccatttcctaacttgaaatccccaaacatgccattagtctttaaggtgtcgaatatcct |
35352614 |
T |
 |
| Q |
220 |
caatctt-gcaaatgtgtattggggaagtagaaccgatcaccaattctggtttaacaatcacctctgtaatttaatagttctaaccacatttgtttgaga |
318 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35352613 |
caatcttggcaaatgtgcattggggaagtagaaccgatcaccaattctggtttaacaatcacctctgtaatttaatagttctaaccacatttgtttgaga |
35352514 |
T |
 |
| Q |
319 |
gttgtcgtcatctttatttatcgtagaataat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35352513 |
gttgtcgtcatctttatttatcgtagaataat |
35352482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University