View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_low_18 (Length: 324)
Name: NF13212_low_18
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 11 - 184
Target Start/End: Complemental strand, 16770053 - 16769880
Alignment:
| Q |
11 |
ttatacttcaatatagatcatggctgccctattcatttatacaaaagagagcttggccaattttaccctattcttattgagatttgtaatctaaactccg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16770053 |
ttatacttcaatatagatcatggctgcccgattcatttatacaaaagagagcttggccaatgttaccctattcttattgagatttgtaatctaaactccg |
16769954 |
T |
 |
| Q |
111 |
gttaagattttgttaccctttgtttacgagggataacacaaataatattctcattgtctattttcgttacgccg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16769953 |
gttaagattttgttaccctttgtttacgagggataacacaaataatattctcattgtctattttcgttacgccg |
16769880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University