View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_low_23 (Length: 298)
Name: NF13212_low_23
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 20 - 284
Target Start/End: Complemental strand, 32210555 - 32210291
Alignment:
| Q |
20 |
atgcatgctgaaaccaaatcagttgattttgttcatttaaagaaacctccagcaaccttagcaaaatcaccacctagtccaccaatcccacctgatcctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210555 |
atgcatgctgaaaccaaatcagttgattttgttcatttaaagaaacctccagcaaccttagcaaaatcaccacctagtccaccaatcccacctgatcctt |
32210456 |
T |
 |
| Q |
120 |
caccttcaggcttagcagcttcatcacttttgggctgatctgcaggtttagaagctggtggagtagcagtagtagtgttctcatacttatgcagataatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210455 |
caccttcaggcttagcagcttcatcacttttgggctgatctgcaggtttagaagctggtggagtagcagtagtagtgttctcatacttatgcagataatc |
32210356 |
T |
 |
| Q |
220 |
agcagctttatcaacatatgatccaacacctttctgatcatccaatttagcatactgaccaactg |
284 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32210355 |
agcagctttatcaacatatgatcctacacctttctgatcatccaatttagcatactgaccaactg |
32210291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 208 - 282
Target Start/End: Complemental strand, 32190992 - 32190918
Alignment:
| Q |
208 |
atgcagataatcagcagctttatcaacatatgatccaacacctttctgatcatccaatttagcatactgaccaac |
282 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
32190992 |
atgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaac |
32190918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University