View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_low_25 (Length: 278)
Name: NF13212_low_25
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 17 - 176
Target Start/End: Original strand, 30088524 - 30088683
Alignment:
| Q |
17 |
tttactagtcggttttgtaagattgatttagattcgatccaaattatacttatgtgtgtggatcaatttggtttaagttttttcacatctaattgtnnnn |
116 |
Q |
| |
|
||||||| || |||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30088524 |
tttactaatcagttttgtaaggttgacttagattcgatctaaattatacttatgtgtgtggatcaatttggtttaagttttttcacaactaattgtaaaa |
30088623 |
T |
|
| Q |
117 |
nnnnnnnngttgaatccgtcttgcaataataatgagtattctaattaatagtttctagta |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30088624 |
aactaaaagttgaatccgtcttgcaataataatgagtattctaattaatagtttcaagta |
30088683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 167 - 260
Target Start/End: Original strand, 30096971 - 30097064
Alignment:
| Q |
167 |
gtttctagtatagaataagttgaaatatttaatctctgcaaggagtatttcacatcactttttatcctttccactaaacatgaatgcttctttt |
260 |
Q |
| |
|
||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30096971 |
gtttcaagtacagagtaagttgaaatatttaatctctgcaaggagtatttcacatcactttttatcctttccactaaatatgaatgcttctttt |
30097064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 30394721 - 30394765
Alignment:
| Q |
15 |
actttactagtcggttttgtaagattgatttagattcgatccaaa |
59 |
Q |
| |
|
||||||| ||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
30394721 |
actttacaagtcgattttgtaagattgaattagattcaatccaaa |
30394765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University