View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_low_34 (Length: 246)
Name: NF13212_low_34
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_low_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 32184681 - 32184441
Alignment:
| Q |
1 |
cccatcactgttttcatctctgatatcttccttctttcacctctcatttcaatcactcaacaactttctctacctaactataccttgtttacttcttcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32184681 |
cccatcactgttttcatctctgatatcttccttctttcacctctcatttcaatcactcaacaactttctctacctaactataccttgtttacttcttcag |
32184582 |
T |
|
| Q |
101 |
cttctatgttctccttcttttctcacttccctactcttgctcaatcaatatctgatgcttctgctgagatttctgagataccagttccaggtattgcatt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32184581 |
cttccatgttctccttcttttctcacttccctactcttgctcaatcaatatctgatgcttctgctgagatttctgagataccagttccaggtattgcatt |
32184482 |
T |
|
| Q |
201 |
ttcacctttaccatattcatctagcccaccgattcttttca |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32184481 |
ttcacctttaccatattcatctatcccaccgattcttttca |
32184441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 32177514 - 32177369
Alignment:
| Q |
1 |
cccatcactgttttcatctctgatatcttccttctttcacctctcatttcaatcactcaacaactttctctacctaactataccttgtttacttcttcag |
100 |
Q |
| |
|
|||||||||||||| |||||||| || | ||| |||| ||||||| | |||||||||| |||||||||| ||||| || | |||| |||||||| |
|
|
| T |
32177514 |
cccatcactgtttttatctctgacatacttcttttttcccctctcaataaaatcactcaaaaactttctctccctaattacatcttgaacacttcttctt |
32177415 |
T |
|
| Q |
101 |
cttctatgttctccttcttttctcacttccctactcttgctcaatc |
146 |
Q |
| |
|
|| ||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
32177414 |
ctgctatgttctccttattctctcatttccctactcttgctcaatc |
32177369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 183 - 230
Target Start/End: Complemental strand, 32177323 - 32177276
Alignment:
| Q |
183 |
agttccaggtattgcattttcacctttaccatattcatctagcccacc |
230 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
32177323 |
agttccaggcattccattttcacctttaccatattcatctatcccacc |
32177276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University