View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13212_low_38 (Length: 239)
Name: NF13212_low_38
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13212_low_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 2 - 239
Target Start/End: Original strand, 29090200 - 29090431
Alignment:
| Q |
2 |
agaaagagaggaagtatacgaagatcaatgttaataggatactcattcataatcatatggttattgttgattgatttcataatgagcttgttgcattctt |
101 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29090200 |
agaaagagaggaagtatatgaagatcaatggtaataggatactcattcat------atggttattgttgatggatttcataatgagcttgttgcattctt |
29090293 |
T |
 |
| Q |
102 |
cctccatggacgctgacatagttcttgtcgatagattccacaacaagtttattgcactcttctccatggcacaattgacatccttggaggaagaaaacag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29090294 |
cctccatggacgctgacatagttcttgtcgatagataccacaacaagtttattgcactcttctccatggcacaattgacatccttggaggaagaaaacag |
29090393 |
T |
 |
| Q |
202 |
ccatggaagatgagtgcaatatactcatcatggaatct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29090394 |
ccatggaagatgagtgcaatatactcatcatggaatct |
29090431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University