View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13212_low_41 (Length: 217)

Name: NF13212_low_41
Description: NF13212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13212_low_41
NF13212_low_41
[»] chr3 (1 HSPs)
chr3 (103-202)||(6786671-6786770)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 103 - 202
Target Start/End: Original strand, 6786671 - 6786770
Alignment:
103 ccttaataatcacctttcctctgtcacatgattatttgtcatattttaacataaatcatctggttttcttattgatactttcaactggctatgttatatt 202  Q
    ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||    
6786671 ccttattaatcacctttcctccgtcacatgattatttgtcatattttaacataaatcatctgtttttcttattcatgctttcaactggctatgttatatt 6786770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University