View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13213_high_6 (Length: 210)
Name: NF13213_high_6
Description: NF13213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13213_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 26180942 - 26180782
Alignment:
| Q |
18 |
gatatcaccttgttcgttggccatagtgaatcaatgatggtatatttgttgaaaatgaatagttgacagtgcatctcttatgcttaaataaacacataca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26180942 |
gatatcaccttgttcgttggccatagtgaat-----------tatttgttgaaaatgaatagttgacagtgcatctcttatgcttaaataaacacataca |
26180854 |
T |
 |
| Q |
118 |
ttgcttgtattttgatgttaaaataacagctcatatttataggtgtccttgtcaattgaagtttcaagtcaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26180853 |
ttgcttgtattttgatgttaaaataacagctcatatttataggcgtccttgtcaattgaagtttcaagtcaa |
26180782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 105 - 191
Target Start/End: Complemental strand, 1189976 - 1189888
Alignment:
| Q |
105 |
ataaacacatacattgcttgtattttgatgttaaaataac--agctcatatttataggtgtccttgtcaattgaagtttcaagtcaacg |
191 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| | |||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
1189976 |
ataaacacatacattgcatgtattttgatgttaaaataacatacctcatatttataggggtcctggtcaattgaagtttcaagttaacg |
1189888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University