View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13213_low_4 (Length: 246)
Name: NF13213_low_4
Description: NF13213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13213_low_4 |
 | |
|
| [»] scaffold1099 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1099 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: scaffold1099
Description:
Target: scaffold1099; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 8 - 158
Target Start/End: Original strand, 2046 - 2196
Alignment:
| Q |
8 |
ccaagaatatagagtcagggtttgatagcctaaccttgaatggaaataaggaacgattgaacaattggactggagcacaggcctaatccaagacagctca |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2046 |
ccaagactatagagtcagggtttgatagcctaaccttgaatggaaataaggaacgattgaacaattggactggagcacaggcctaatccaagacagctca |
2145 |
T |
|
| Q |
108 |
aggccaggaacaagaaggaaacccaccagctgaagactagtttaacaactc |
158 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2146 |
agcccaggaacaagaaggaaacccaccagctgaagactagtttaacaactc |
2196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 171 - 229
Target Start/End: Original strand, 53680340 - 53680398
Alignment:
| Q |
171 |
tgaattgtgatcactacttctatttcttcttggtattatttcaaattcaagttaatatt |
229 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53680340 |
tgaattgtgataactacttctatttcttcttggtattatttcaaattcaagttaatatt |
53680398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University