View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13214_high_31 (Length: 222)
Name: NF13214_high_31
Description: NF13214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13214_high_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 105
Target Start/End: Original strand, 14699367 - 14699454
Alignment:
| Q |
18 |
gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14699367 |
gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc |
14699454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 8551920 - 8551833
Alignment:
| Q |
18 |
gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
8551920 |
gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagttctggatgacggc |
8551833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 41643246 - 41643159
Alignment:
| Q |
18 |
gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| || |||||||||| |
|
|
| T |
41643246 |
gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtggaaggatgcggtggtgcggaggtctggatgacggc |
41643159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University