View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13214_low_24 (Length: 255)
Name: NF13214_low_24
Description: NF13214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13214_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 234
Target Start/End: Original strand, 19702937 - 19703160
Alignment:
| Q |
11 |
cagagataaaccaatgccagccaacttatcagcataatgattcccctctctatagatataagaaacaaacaattttcccatctgtttcttaaattgcaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19702937 |
cagagataaaccaatgccagccaacttatcagcataatgattcccctctctatagatataagaaacaaacaattttcccatctgtttcttaaattgcaag |
19703036 |
T |
 |
| Q |
111 |
acataatggttctagacataaaagctagaatgactaacattgactctgtttctaaccaaagatggttccgacctttttgagcagccatttgaatttatat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19703037 |
acataatggttctagacataaaagctagaatgactaacattgagtctgtttctaaccaaagatggttccgacctttttgagcagccatttgaatttatat |
19703136 |
T |
 |
| Q |
211 |
attatagcaccctgaagctcagca |
234 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
19703137 |
attatagcaccctgaagctcagca |
19703160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 124 - 171
Target Start/End: Complemental strand, 16187242 - 16187195
Alignment:
| Q |
124 |
agacataaaagctagaatgactaacattgactctgtttctaaccaaag |
171 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
16187242 |
agacttaaaagctagaaaaactaacattgaatctgtttctaaccaaag |
16187195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University