View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13214_low_31 (Length: 222)

Name: NF13214_low_31
Description: NF13214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13214_low_31
NF13214_low_31
[»] chr7 (1 HSPs)
chr7 (18-105)||(14699367-14699454)
[»] chr6 (1 HSPs)
chr6 (18-105)||(8551833-8551920)
[»] chr5 (1 HSPs)
chr5 (18-105)||(41643159-41643246)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 105
Target Start/End: Original strand, 14699367 - 14699454
Alignment:
18 gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14699367 gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc 14699454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 8551920 - 8551833
Alignment:
18 gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||    
8551920 gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagttctggatgacggc 8551833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 18 - 105
Target Start/End: Complemental strand, 41643246 - 41643159
Alignment:
18 gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtgggaggatgtggtggtgcggagatcaggatgacggc 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| || ||||||||||    
41643246 gtgacgacgatggaggatgatgactgatgagaatggtggttgttgtgacggtggaaggatgcggtggtgcggaggtctggatgacggc 41643159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University