View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13215_low_19 (Length: 265)
Name: NF13215_low_19
Description: NF13215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13215_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 94 - 255
Target Start/End: Complemental strand, 21435867 - 21435706
Alignment:
| Q |
94 |
gatatgaataactcccacgatgaatagaaattgttgatgacgttgacttcatacaataaacatcaactttggacactcgtcggtggttccatatatcaac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21435867 |
gatatgaataactcccacgatgaatagaaattgttgatgacgttgacttcatacaataaacatcaactttgggcagtcgtcggtggttccatatatcaac |
21435768 |
T |
 |
| Q |
194 |
ttaagatccctagattgtcattgtgaccggatgctctttttaatcatcaagtttgttctgtg |
255 |
Q |
| |
|
||||| |||||| |||||||||| |||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
21435767 |
ttaagctccctatattgtcattgcgaccggatgctctttttaatcaccaagtttgtcctgtg |
21435706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 21441165 - 21441068
Alignment:
| Q |
1 |
cttttagataatagaaatgcttggagttctctccttatagatcaaatgtttgcattgaaggctaaatgttggccattgtcgataaccatagttgatat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21441165 |
cttttagataatagaaatgcttggagttctctccttatagatcaaatgtttgcattgaaggctaaatgttggccattgtcgataaccatagttgatat |
21441068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University