View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13215_low_23 (Length: 238)
Name: NF13215_low_23
Description: NF13215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13215_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 4058935 - 4059162
Alignment:
| Q |
1 |
taagcacaatatagtcaagtatgaaagttat---atgatatatcaacatgaaattcaatcaatacataacacggcagttatgaccatataatataactta |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058935 |
taagcacaatatagtcaagtatgaaagttattatatgatatatcaacatgaaattcaatcaatacataacacggcagttatgaccatataatataactta |
4059034 |
T |
 |
| Q |
98 |
aaatcaaacagtgtatatgtttctaactcattttgctactattttccccgataaaagagttaatccattaatt----tcactaaatcgagcttaagcaat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4059035 |
aaatcaaacagtgtatatgtttctaactcattttgctactattttccccgataaaagagttaatccattaatttcactcactaaatcgagcttaagcaat |
4059134 |
T |
 |
| Q |
194 |
tggtaagcatgagtaagggtggacaaaa |
221 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
4059135 |
tggtaagcaagagtaagggtggacaaaa |
4059162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University