View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13215_low_24 (Length: 238)
Name: NF13215_low_24
Description: NF13215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13215_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 6445250 - 6445375
Alignment:
| Q |
1 |
tcctattttctccttttatgtatggttgtatttcaataaacggttggttgtgtgacagaaaattgttccattcatattcaactgtcattcaatacaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6445250 |
tcctattttctccttttatgtatggttgtatttcaataaacggttggttgtgtggcagaaaattgttccattcatattcaactgtcattcaatacaaata |
6445349 |
T |
 |
| Q |
101 |
tatatagaagggttacttatttaaaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6445350 |
tatatagaagggttacttatttaaaa |
6445375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 228
Target Start/End: Original strand, 6445369 - 6445440
Alignment:
| Q |
156 |
tttaaaaagattaatgaggaaatggaattatttaccctgaatnnnnnnntgtgatatagatttgagagatgat |
228 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
6445369 |
tttaaaaagattaatgaggaaattgaattaattaccctgaa-aaaaaaatgtgatatagatttgagagatgat |
6445440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University