View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13216_high_7 (Length: 223)
Name: NF13216_high_7
Description: NF13216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13216_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 27 - 206
Target Start/End: Complemental strand, 47735943 - 47735763
Alignment:
| Q |
27 |
taaataaattaagttaccaacggaaattatggaccgaaaaaa-tgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactgac |
125 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735943 |
taaataaattgagttaccaacggaaattatggaccgaaaaaaatgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactgac |
47735844 |
T |
|
| Q |
126 |
aatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttgg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735843 |
aatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttgg |
47735763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University