View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13216_high_7 (Length: 223)

Name: NF13216_high_7
Description: NF13216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13216_high_7
NF13216_high_7
[»] chr4 (1 HSPs)
chr4 (27-206)||(47735763-47735943)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 27 - 206
Target Start/End: Complemental strand, 47735943 - 47735763
Alignment:
27 taaataaattaagttaccaacggaaattatggaccgaaaaaa-tgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactgac 125  Q
    |||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47735943 taaataaattgagttaccaacggaaattatggaccgaaaaaaatgatatatgtaacacttagcaacgaaattatgaacggatttcatttttagtactgac 47735844  T
126 aatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttgg 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47735843 aatgtaagaatttgcagggaacggcgttactctttgatttaaaccatcaattaccattgacaatggaagttgaatccttgg 47735763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University