View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13217_high_10 (Length: 383)

Name: NF13217_high_10
Description: NF13217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13217_high_10
NF13217_high_10
[»] chr7 (2 HSPs)
chr7 (14-334)||(42091786-42092111)
chr7 (338-368)||(42091676-42091706)
[»] chr8 (1 HSPs)
chr8 (109-168)||(7246546-7246605)
[»] chr4 (1 HSPs)
chr4 (111-168)||(52052018-52052075)
[»] chr2 (1 HSPs)
chr2 (111-164)||(18199801-18199854)
[»] scaffold0001 (1 HSPs)
scaffold0001 (111-167)||(399133-399189)


Alignment Details
Target: chr7 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 14 - 334
Target Start/End: Complemental strand, 42092111 - 42091786
Alignment:
14 caaagggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaaggcaaagcagagaaagatccactgccattactagttggtgtgggaagttc 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||    
42092111 caaaaggagatttgaatgaggaagtgacaagaggctgtgaagaaatagaagacaaagcagagaaagatccaccgccattactagttggtgtgggaagttc 42092012  T
114 cacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttttgtccagccaccacatccctcgcacaccgccactttttaccgtct 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42092011 cacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttttgtccagccaccacatccctcgcacaccgccactttttaccgtct 42091912  T
214 gttctccggcaacgacctggctctggatccattgctcctcttccccaatacccactttgcaacactaataaaacaca-----aaacnnnnnnnntattct 308  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     ||||        ||||||    
42091911 gttctccggcaacgacctggctctggatccattgctcctcttccccaatacccactttgcaacactaataaaacacaaaacaaaacaaaacaaatattct 42091812  T
309 aaatatacctcattttggggaatatt 334  Q
    ||||||||||||||||||||||||||    
42091811 aaatatacctcattttggggaatatt 42091786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 338 - 368
Target Start/End: Complemental strand, 42091706 - 42091676
Alignment:
338 tgagagaaaccaagtagtagaatgaaactta 368  Q
    |||||||||||||||||||||||||||||||    
42091706 tgagagaaaccaagtagtagaatgaaactta 42091676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 109 - 168
Target Start/End: Original strand, 7246546 - 7246605
Alignment:
109 agttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttt 168  Q
    |||||||||||||||||||||||||||||||| |  ||||||||||||||||||||||||    
7246546 agttccacaggctttcttgaacggtttctacctctgtgcatgtgtctttcacagtacttt 7246605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 168
Target Start/End: Complemental strand, 52052075 - 52052018
Alignment:
111 ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttt 168  Q
    ||||||||||||||||||||||||| | || | ||||||||| |||||||||||||||    
52052075 ttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtacttt 52052018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 164
Target Start/End: Original strand, 18199801 - 18199854
Alignment:
111 ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagta 164  Q
    ||||||||||||||||||||||||| | || | |||||||||||||||||||||    
18199801 ttccacaggctttcttgaacggttttttcctctatgcatgtgtctttcacagta 18199854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 111 - 167
Target Start/End: Complemental strand, 399189 - 399133
Alignment:
111 ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtactt 167  Q
    |||||||||||||||||||||||| |  ||||| |||||||| |  |||||||||||    
399189 ttccacaggctttcttgaacggttgcggccacggtgcatgtggcgctcacagtactt 399133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University